👩‍🔬 leapdna

← Back to Explore

D1GATA113

Locus information

Name
D1GATA113
Type
STR
Location
Chromosome 1, band 1p36.23
GRCh38 coordinates
7382711 - 7382974
Repeat motif
[GATA]n
Reference sequence
TTGATGAGCCCTCCTGCAGGCAAAAGAATAAAAGGACAACAATATTTGACATAAAACATTAAGCACATGCCTCTTTGTTGCAGTGATTTCTTAGCCTAGATAGATACTTGCTTCCTAGATGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATATTCCTATAGCCTCAAAGGTTGAGTCTAGGAAATTTTGAGAAAATGCTTTCCTTTTGCCAATGAGTTCATTTATTTATACAACCAGTATCTATTTACTGAG
Aliases
No other names known.

Bibliographic information

Date published
2018
Title
“The Devil's in the Detail”: Release of an Expanded, Enhanced and Dynamically Revised Forensic STR Sequence Guide
Authors
C. Phillips, K. Butler Gettings, J. L. King, D. Ballard, M. Bodner, L. Borsuk, and W. Parson
Journal
Forensic Science International: Genetics
Abstract

The STR sequence template file published in 2016 as part of the considerations from the DNA Commission of the International Society for Forensic Genetics on minimal STR sequence nomenclature requirements, has been comprehensively revised and audited using the latest GRCh38 genome assembly. The list of forensic STRs characterized was expanded by including supplementary autosomal, X- and Y-chromosome microsatellites in less common use for routine DNA profiling, but some likely to be adopted in future massively parallel sequencing (MPS) STR panels. We outline several aspects of sequence alignment and annotation that required care and attention to detail when comparing sequences to GRCh37 and GRCh38 assemblies, as well as the necessary matching of MPS-based allele descriptions to previously established repeat region structures described in initial sequencing studies of the less well known forensic STRs. The revised sequence guide is now available in a dynamically updated FTP format from the STRidER website with a date-stamped change log to allow users to explore their own MPS data with the most up-to-date forensic STR sequence information compiled in a simple guide.

Studies with this locus

There are no studies with this locus available on leapdna yet.